View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_217 (Length: 250)
Name: NF0928_high_217
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_high_217 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 21 - 112
Target Start/End: Original strand, 15639075 - 15639166
Alignment:
Q |
21 |
tattcatagaaatcataattaaatgaatttgagagtaaactgtttgaggataatttatgcatattcataaaaaactacaccaagaaagtata |
112 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
15639075 |
tattcatagaaatcataattcaatgaatttgagagtaaacggtttgaggataatttatgcatattcataataaactacaccaagaaagtata |
15639166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 403 times since January 2019
Visitors: 6714