View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_224 (Length: 246)
Name: NF0928_high_224
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_high_224 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 20 - 143
Target Start/End: Original strand, 12943823 - 12943946
Alignment:
| Q |
20 |
acatggaatgtgagagattgatacctagatactaaggaaaaattaggatagaatataagtaaatttatgaatacatgagtcatgcaagaaaggtatggat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12943823 |
acatggaatgtgagagattgatacctagatactaaggaaaaattaggttagaatataagtaaatttatgaatacatgagtcatgcaagaaaggtatggat |
12943922 |
T |
 |
| Q |
120 |
gaagattagtttattcctcctaaa |
143 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
12943923 |
gaagattagtttattcctcctaaa |
12943946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University