View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_high_224 (Length: 246)

Name: NF0928_high_224
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_high_224
NF0928_high_224
[»] chr8 (1 HSPs)
chr8 (20-143)||(12943823-12943946)


Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 20 - 143
Target Start/End: Original strand, 12943823 - 12943946
Alignment:
20 acatggaatgtgagagattgatacctagatactaaggaaaaattaggatagaatataagtaaatttatgaatacatgagtcatgcaagaaaggtatggat 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
12943823 acatggaatgtgagagattgatacctagatactaaggaaaaattaggttagaatataagtaaatttatgaatacatgagtcatgcaagaaaggtatggat 12943922  T
120 gaagattagtttattcctcctaaa 143  Q
    ||||||||||||||||||||||||    
12943923 gaagattagtttattcctcctaaa 12943946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 851 times since January 2019
Visitors: 6719