View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_high_228 (Length: 240)

Name: NF0928_high_228
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_high_228
NF0928_high_228
[»] chr5 (1 HSPs)
chr5 (20-222)||(735616-735818)


Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 20 - 222
Target Start/End: Original strand, 735616 - 735818
Alignment:
20 agaatagttttctacgatgaagctgatgataacgatatgtgggtgatttgtccgttcaagaattgctcaggttatctcttgaatgatgggtttcaaactg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
735616 agaatagttttctacgatgaagctgatgataacgatatgtgggtgatttgtccgttcaagaattgctcaggttatctcttgaatgatgggtttcaaactg 735715  T
120 ttattgatgcagattgccccatttgtcataggttattctgctcgcgatgcaaagttccttggcatgcaggtgaaacctgtcaacaattccaacacaacaa 219  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
735716 ttattgatgcagattgccccatttgtcataggttattctgctcgcgatgcaacgttccttggcatgcaggtgaaacctgtcaacaattccaacacaacaa 735815  T
220 act 222  Q
    |||    
735816 act 735818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University