View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_228 (Length: 240)
Name: NF0928_high_228
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_high_228 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 20 - 222
Target Start/End: Original strand, 735616 - 735818
Alignment:
| Q |
20 |
agaatagttttctacgatgaagctgatgataacgatatgtgggtgatttgtccgttcaagaattgctcaggttatctcttgaatgatgggtttcaaactg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
735616 |
agaatagttttctacgatgaagctgatgataacgatatgtgggtgatttgtccgttcaagaattgctcaggttatctcttgaatgatgggtttcaaactg |
735715 |
T |
 |
| Q |
120 |
ttattgatgcagattgccccatttgtcataggttattctgctcgcgatgcaaagttccttggcatgcaggtgaaacctgtcaacaattccaacacaacaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
735716 |
ttattgatgcagattgccccatttgtcataggttattctgctcgcgatgcaacgttccttggcatgcaggtgaaacctgtcaacaattccaacacaacaa |
735815 |
T |
 |
| Q |
220 |
act |
222 |
Q |
| |
|
||| |
|
|
| T |
735816 |
act |
735818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University