View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_229 (Length: 239)
Name: NF0928_high_229
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_high_229 |
 |  |
|
[»] chr2 (2 HSPs) |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 128 - 239
Target Start/End: Original strand, 34617979 - 34618090
Alignment:
Q |
128 |
ctcgggtgggccaccgaaataagtaataataataattacagttttgtttgcaaatgacaacatgggatgatcaggtagaagatgcagtcaatagaaaagt |
227 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |||| ||||||||||||| ||| |||||||||||||||||||||| |
|
|
T |
34617979 |
ctcgggtgggccaccaaaataagtaataataataattacagttttatttgcaaaggacagcatgggatgatcaagtacaagatgcagtcaatagaaaagt |
34618078 |
T |
 |
Q |
228 |
agcagcaatatt |
239 |
Q |
|
|
|||||||||||| |
|
|
T |
34618079 |
agcagcaatatt |
34618090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 65 - 112
Target Start/End: Original strand, 34617887 - 34617934
Alignment:
Q |
65 |
ctctatctaatctctacttcttcaagcttctttgcctcctgaacacat |
112 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34617887 |
ctctatctaatctctacttcttcaagcttctttgcctcctgaacacat |
34617934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 151 - 239
Target Start/End: Complemental strand, 34709995 - 34709907
Alignment:
Q |
151 |
taataataataattacagttttgtttgcaaatgacaacatgggatgatcaggtagaagatgcagtcaatagaaaagtagcagcaatatt |
239 |
Q |
|
|
||||||||||||||||| ||||||||||||| ||| |||||||||||||| ||| ||||||||||||||||||||||||| |||||||| |
|
|
T |
34709995 |
taataataataattacaattttgtttgcaaacgacgacatgggatgatcaagtacaagatgcagtcaatagaaaagtagctgcaatatt |
34709907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 128 - 239
Target Start/End: Complemental strand, 26764828 - 26764721
Alignment:
Q |
128 |
ctcgggtgggccaccgaaataagtaataataataattacagttttgtttgcaaatgacaacatgggatgatcaggtagaagatgcagtcaatagaaaagt |
227 |
Q |
|
|
|||||||||||| || |||| |||||||| |||||||| ||||||||||||| ||||| |||||||||||| ||| | ||||||||||||||||||| |
|
|
T |
26764828 |
ctcgggtgggccgccaaaattagtaataa---taattacaattttgtttgcaaacgacaatatgggatgatcaagta-catatgcagtcaatagaaaagt |
26764733 |
T |
 |
Q |
228 |
agcagcaatatt |
239 |
Q |
|
|
|||| ||||||| |
|
|
T |
26764732 |
agcaacaatatt |
26764721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 154 - 239
Target Start/End: Original strand, 47667281 - 47667366
Alignment:
Q |
154 |
taataataattacagttttgtttgcaaatgacaacatgggatgatcaggtagaagatgcagtcaatagaaaagtagcagcaatatt |
239 |
Q |
|
|
|||||||||||||||||||| ||||||| ||| |||| | ||||||| || ||||||||||||||| ||||||||||||||||| |
|
|
T |
47667281 |
taataataattacagttttgcttgcaaacgacgacatagaatgatcaattacaagatgcagtcaatattaaagtagcagcaatatt |
47667366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 77 times since January 2019
Visitors: 6713