View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_232 (Length: 237)
Name: NF0928_high_232
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_high_232 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 55 - 216
Target Start/End: Complemental strand, 43194205 - 43194044
Alignment:
| Q |
55 |
catgtgattttcagttacattgtgttttaagtgtgagattgaatcggttgatgacctaaccaatgattatatctaaactgaagtttgttaaatatttgat |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43194205 |
catgtgattttcagttacattgtgttttaagtgtgagattgaatcggttgatgacctaaccaatgattatatctaaactgaagtctgttaaatatttgat |
43194106 |
T |
 |
| Q |
155 |
gttattaaaattannnnnnnnnnnnnaattgatatttgatttggttcttggtgttgatgatg |
216 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||| |||||| |
|
|
| T |
43194105 |
gttattaaaattatttttatttttttaattgagatttgatttggttcttggtgttaatgatg |
43194044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 43194259 - 43194225
Alignment:
| Q |
1 |
tttcattttccctctttactaattaaaattgatta |
35 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
43194259 |
tttcattttctctctttactaattaaaattgatta |
43194225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University