View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_234 (Length: 228)
Name: NF0928_high_234
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_high_234 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 47320152 - 47320055
Alignment:
| Q |
1 |
tgcaggattgtagtcaaacttgttattgttcgtcatctttctcttcatctttgagtgc------cgcttcatcaacttgaagttcatatttcaactct |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47320152 |
tgcaggattgtagtcaaacttgttattgttcgtcatctttctcttcatctttgagtgccgctgccgcttcatcaacttgaagttcatatttcaactct |
47320055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 81
Target Start/End: Complemental strand, 47311332 - 47311272
Alignment:
| Q |
21 |
tgttattgttcgtcatctttctcttcatctttgagtgccgcttcatcaacttgaagttcat |
81 |
Q |
| |
|
||||||| ||| |||| ||||| ||||||||||||||| || ||||| |||||||||||| |
|
|
| T |
47311332 |
tgttattcttcatcatttttctgctcatctttgagtgccactccatcaccttgaagttcat |
47311272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University