View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_247 (Length: 218)
Name: NF0928_high_247
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_high_247 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 55694313 - 55694372
Alignment:
Q |
1 |
ttaatttctgtcagtgacatgaggtgtctgcttgaaaaagattcttccaagtggccacag |
60 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
55694313 |
ttaatttctgtcagtgacatgaggtgtctgcttgaaaaagattcttccaagtggccacag |
55694372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 218
Target Start/End: Original strand, 55694483 - 55694546
Alignment:
Q |
154 |
atttcttttgtaattcatctttccattcccaaatggccactgttgaggtaattcaaagatatagt |
218 |
Q |
|
|
|||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
55694483 |
atttcttttgtaattcctctttccattcc-aaatggccactgttgaggtaattcaaagatatagt |
55694546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University