View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_high_249 (Length: 216)

Name: NF0928_high_249
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_high_249
NF0928_high_249
[»] chr1 (1 HSPs)
chr1 (36-136)||(31052585-31052684)


Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 36 - 136
Target Start/End: Complemental strand, 31052684 - 31052585
Alignment:
36 aataagataaaattttggcctaaatatatgttatattatatgctatgaaatatacttcagaatcacaccaaattgagatcaatcgaagcaacagacaaag 135  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||    
31052684 aataagataaaattt-ggcctaaatatatgttatattatatgctatgaaatatacttcataatcacaccaaattgagattaatcgaagcaacagataaag 31052586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University