View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_250 (Length: 214)
Name: NF0928_high_250
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_high_250 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 5 - 47
Target Start/End: Original strand, 31052642 - 31052684
Alignment:
Q |
5 |
agcatataatataacatatatttaggccaatttttatcttatt |
47 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
31052642 |
agcatataatataacatatatttaggccaaattttatcttatt |
31052684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University