View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_high_251 (Length: 214)

Name: NF0928_high_251
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_high_251
NF0928_high_251
[»] chr8 (1 HSPs)
chr8 (1-119)||(8888016-8888134)


Alignment Details
Target: chr8 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 8888134 - 8888016
Alignment:
1 ttagatgtttgtactatttatctatatcaattgagtgtgtattcaacttttggagggtaggttcattatacctgtgttgattattgatattcaccatctt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8888134 ttagatgtttgtactatttatctatatcaattgagtgtgtattcaacttttggagggtaggttcattatacctgtgttgattattgatattcaccatctt 8888035  T
101 ttttgattgatcatgccaa 119  Q
    |||||||||||||||||||    
8888034 ttttgattgatcatgccaa 8888016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University