View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_252 (Length: 211)
Name: NF0928_high_252
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_high_252 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 42 - 146
Target Start/End: Complemental strand, 45937098 - 45936994
Alignment:
| Q |
42 |
tagaccataattagtactactaaatataattatatgtaattatgaactaattaatcaattaaattgcttacgttccaacatataatttctcccgaagaaa |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45937098 |
tagaccataattagtactactaaatataattatatgtaattatgaactaattaatcaattaaattgcttacgttccaacatataatttctcccgaagaaa |
45936999 |
T |
 |
| Q |
142 |
agccc |
146 |
Q |
| |
|
||||| |
|
|
| T |
45936998 |
agccc |
45936994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 151 - 191
Target Start/End: Complemental strand, 9453007 - 9452967
Alignment:
| Q |
151 |
tgttgctcttttaagatgaagcggtgaattcattaaatata |
191 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9453007 |
tgttgctcttttaagatgaagcggtaaattcattaaatata |
9452967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 151 - 191
Target Start/End: Complemental strand, 46424194 - 46424154
Alignment:
| Q |
151 |
tgttgctcttttaagatgaagcggtgaattcattaaatata |
191 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46424194 |
tgttgctcttttaagatgaagcgatgaattcattaaatata |
46424154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University