View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_high_252 (Length: 211)

Name: NF0928_high_252
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_high_252
NF0928_high_252
[»] chr7 (1 HSPs)
chr7 (42-146)||(45936994-45937098)
[»] chr4 (1 HSPs)
chr4 (151-191)||(9452967-9453007)
[»] chr1 (1 HSPs)
chr1 (151-191)||(46424154-46424194)


Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 42 - 146
Target Start/End: Complemental strand, 45937098 - 45936994
Alignment:
42 tagaccataattagtactactaaatataattatatgtaattatgaactaattaatcaattaaattgcttacgttccaacatataatttctcccgaagaaa 141  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45937098 tagaccataattagtactactaaatataattatatgtaattatgaactaattaatcaattaaattgcttacgttccaacatataatttctcccgaagaaa 45936999  T
142 agccc 146  Q
    |||||    
45936998 agccc 45936994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 151 - 191
Target Start/End: Complemental strand, 9453007 - 9452967
Alignment:
151 tgttgctcttttaagatgaagcggtgaattcattaaatata 191  Q
    ||||||||||||||||||||||||| |||||||||||||||    
9453007 tgttgctcttttaagatgaagcggtaaattcattaaatata 9452967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 151 - 191
Target Start/End: Complemental strand, 46424194 - 46424154
Alignment:
151 tgttgctcttttaagatgaagcggtgaattcattaaatata 191  Q
    ||||||||||||||||||||||| |||||||||||||||||    
46424194 tgttgctcttttaagatgaagcgatgaattcattaaatata 46424154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University