View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_255 (Length: 207)
Name: NF0928_high_255
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_high_255 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 3e-62; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 62 - 194
Target Start/End: Original strand, 13740527 - 13740659
Alignment:
Q |
62 |
gcaggctttacttggagtcatatttatttttgtttgtgattttgctacttgttgtttgtctgaggtgaacttctaggggcatgttttagttatgggggta |
161 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13740527 |
gcaggctttacttggagtcatatttgtttttgtttgtaattttgctacatgttgtttgtctgaggtgaacttctaggggcatgttttagttatgggggta |
13740626 |
T |
 |
Q |
162 |
ttgtggagtggagtgttttgtattgttctgtgc |
194 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
13740627 |
ttgtggagtggagtgttttgtattgttctgtgc |
13740659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 62 - 194
Target Start/End: Original strand, 13746027 - 13746159
Alignment:
Q |
62 |
gcaggctttacttggagtcatatttatttttgtttgtgattttgctacttgttgtttgtctgaggtgaacttctaggggcatgttttagttatgggggta |
161 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13746027 |
gcaggctttacttggagtcatatttgtttttgtttgtaattttgctacatgttgtttgtctgaggtgaacttctaggggcatgttttagttatgggggta |
13746126 |
T |
 |
Q |
162 |
ttgtggagtggagtgttttgtattgttctgtgc |
194 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
13746127 |
ttgtggagtggagtgttttgtattgttctgtgc |
13746159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University