View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_256 (Length: 207)
Name: NF0928_high_256
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_high_256 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 36 - 129
Target Start/End: Complemental strand, 31052684 - 31052592
Alignment:
| Q |
36 |
aataagataaaattttggcctaaatatatgttatattatatgctatgaaatatacttcagaatcacaccaaattgagatcaatcgaagcaacag |
129 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
31052684 |
aataagataaaattt-ggcctaaatatatgttatattatatgctatgaaatatacttcataatcacaccaaattgagattaatcgaagcaacag |
31052592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 399 times since January 2019
Visitors: 6714