View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_53 (Length: 446)
Name: NF0928_high_53
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_high_53 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 5e-66; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 276 - 435
Target Start/End: Complemental strand, 32866513 - 32866354
Alignment:
Q |
276 |
gtaaggtttgttgtttcacctcagcnnnnnnnngtaaggttttttgcgtgaatcaaatgactaaacaattgtgcttctatgggaattttgattgaacatt |
375 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32866513 |
gtaaggtttgttgtttcacctcagcaaaaaaaagtaaggttttttgcgtgaatcaaatgactaaacaattgtgcttctatgggaattttgattgaacatt |
32866414 |
T |
 |
Q |
376 |
gcaagttaattaggtgaatttaattatttttgaatgaatcaaatgactttacatcttcat |
435 |
Q |
|
|
| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
32866413 |
gtaagttaattaggtgaatttaattatttttgaatgaaacaaatgactttacatcttcat |
32866354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 29 - 155
Target Start/End: Complemental strand, 32866742 - 32866615
Alignment:
Q |
29 |
tattcggttggatttggctgtggagattttacgattacaagcatgtgaatgttgccgccgctgtgggtataattaggttagggta-nnnnnnnctcaaac |
127 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
T |
32866742 |
tattcggttggatttggctgtggagattttacgattacaagcatgtgaatgttgccgccgctgtgagtataattaggttagggtattttttttctcaaac |
32866643 |
T |
 |
Q |
128 |
gaacgttctttgattggtttgttctttt |
155 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
32866642 |
gaacgttctttgattggtttgttctttt |
32866615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 153 - 217
Target Start/End: Complemental strand, 32866584 - 32866520
Alignment:
Q |
153 |
tttttaattgatgtttggctacactagattgtcaacatgggctccactttctatcagaaaattta |
217 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32866584 |
tttttaattgatgtttggctacactagattgtcaacatgggctccactttctatcagaaaattta |
32866520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University