View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_high_58 (Length: 423)

Name: NF0928_high_58
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_high_58
NF0928_high_58
[»] chr7 (1 HSPs)
chr7 (54-187)||(15638743-15638874)
[»] chr3 (1 HSPs)
chr3 (244-318)||(48047492-48047566)


Alignment Details
Target: chr7 (Bit Score: 84; Significance: 9e-40; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 54 - 187
Target Start/End: Original strand, 15638743 - 15638874
Alignment:
54 gatttgaagaaatgattgatagtcaaagaatccattgaaaaacaa--ttaagaaaatgcatttataagtttcttcctatcttttatcatccgtttatatg 151  Q
    |||||||| ||||||||| ||||||||||| ||||||||||| ||  |||||||||||||||||||||||||||||| |||||||||||||||||||       
15638743 gatttgaaaaaatgattgttagtcaaagaacccattgaaaaaaaaaattaagaaaatgcatttataagtttcttcctgtcttttatcatccgtttat--- 15638839  T
152 aatgaattggtagtagtcaaagtatattagcataaa 187  Q
     ||||||| |||||||||||||||||||||||||||    
15638840 -atgaattagtagtagtcaaagtatattagcataaa 15638874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 244 - 318
Target Start/End: Complemental strand, 48047566 - 48047492
Alignment:
244 ttaaagcatttt-tggcttcagttctagctaaaaaaccaagctcgtgataatgttttgatactatgaaaatcaaca 318  Q
    ||||||||| || |||||||||||||||||||||| |||||| | ||| |||||||||||||||| |||| |||||    
48047566 ttaaagcatgttctggcttcagttctagctaaaaa-ccaagcccatgacaatgttttgatactataaaaaacaaca 48047492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 386 times since January 2019
Visitors: 6714