View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_61 (Length: 418)
Name: NF0928_high_61
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_high_61 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 375; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 375; E-Value: 0
Query Start/End: Original strand, 31 - 409
Target Start/End: Original strand, 12669968 - 12670346
Alignment:
| Q |
31 |
catggtggtcatgaacttgctcctactagtactcatcacatgcatgagattttccttattgggacctgtatcatatgaatcatactcttaattagtgatt |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12669968 |
catggtggtcatgaacttgctcctactagtactcatcacatgcatgagattttccttattgggacctgtatcatatgaatcatactcttaattagtgatt |
12670067 |
T |
 |
| Q |
131 |
gcagagaatgaagaaagaatggcaggagcagtactagccagctttagatttataaatagaaattttatgtatattattataatataaagtaaagtttttc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12670068 |
gcagagaatgaagaaagaatggcaggagcagtactagccagctttagatttataaatagaaattttatgtatattattataatataaagtaaggtttttc |
12670167 |
T |
 |
| Q |
231 |
agatgatcaaagtaaaatatagaaaaagctagtatataaagatatgcctttaacattaatttagcatatgaaaaaggttttgagctatgactatatgatg |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12670168 |
agatgatcaaagtaaaatatagaaaaagctagtatataaagatatgcctttaacattaatttagcatatgaaaaaggttttgagctatgactatatgatg |
12670267 |
T |
 |
| Q |
331 |
aaagtaaaatgattatggagatttccacattgaacaagtctagtagtacctttgacaaatttgtcttttggtttcatct |
409 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12670268 |
aaagtaaaatgattatggagatttccacattgaacaagtctagtagtacctttgacaaatttgtcttttggtttcatct |
12670346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University