View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_65 (Length: 402)
Name: NF0928_high_65
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_high_65 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 3e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 3e-92
Query Start/End: Original strand, 97 - 305
Target Start/End: Original strand, 15591413 - 15591623
Alignment:
Q |
97 |
agctgatgatgattctatgcaaaatcttagccagatcagcaactcctttgagaaaactttgggccttatccatcagctttaccaccttaccgtctccacc |
196 |
Q |
|
|
||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15591413 |
agctgatgatgattctacgcaaaatctgagccagatcagcaactcctttgagaaaacgttcggccttatccatcagctttaccaccttaccgtctccacc |
15591512 |
T |
 |
Q |
197 |
ttgaacgttgtcttttaaatgtcactgca--ttttttataggtctttgtcttaacggtgatgatcaaaataccctgcactttcataatgactagcaaagc |
294 |
Q |
|
|
||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
T |
15591513 |
ttgaacgttgtctttcaaatgtcactgcattttttttataggtctttgtcttaacggtgatgatcagaataccctgcactttcatgatgactagcaaagc |
15591612 |
T |
 |
Q |
295 |
aatttcatctc |
305 |
Q |
|
|
||||||||||| |
|
|
T |
15591613 |
aatttcatctc |
15591623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 103 - 174
Target Start/End: Complemental strand, 35445739 - 35445668
Alignment:
Q |
103 |
tgatgattctatgcaaaatcttagccagatcagcaactcctttgagaaaactttgggccttatccatcagct |
174 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||| |||||||||| ||||||| ||||||||||| |
|
|
T |
35445739 |
tgatgattctatgcaaaaccttagccagatcagcaactccattgagaaaaccctgggcctcatccatcagct |
35445668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University