View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_81 (Length: 376)
Name: NF0928_high_81
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_high_81 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 9e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 107 - 283
Target Start/End: Original strand, 32502156 - 32502332
Alignment:
| Q |
107 |
aacaagtagtactgttgttctgggcatggtaatgttgcatctaaactaattgagtactgttgtcctagttaacacagttgcaaaatgaattataacctag |
206 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32502156 |
aacaagtagtactaatgttctgggcatggtaatgttgcatctaaactaattgagtactgttgtcctagttaacacagttgcaaaatgaattataacctag |
32502255 |
T |
 |
| Q |
207 |
ttgaaaatgaattttaatctggctgcagtttactgtaacaaagacaaactaaatttgttttggattaatgatgatgt |
283 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32502256 |
ttgaaaatgaattttaatccggctgcagtttactgtaacaaagacaaactaaatttgttttggattaatgataatgt |
32502332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University