View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_84 (Length: 371)
Name: NF0928_high_84
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_high_84 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 6e-87; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 29 - 215
Target Start/End: Original strand, 38295317 - 38295503
Alignment:
| Q |
29 |
aatataatcaaacaaacccttgcaaaatgtaatgtcctggctgcgggtaattacaatgtgtgtagttacccgtccattgtgagtattttttaaagatgca |
128 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38295317 |
aatataatcaaacaaacccttgcaacatgtaatgtcctggctgcgggtaattacaatgtgtgtagttacccgtccattgtgaatattttttaaagatgca |
38295416 |
T |
 |
| Q |
129 |
tattgattgaacttggatctaattgtcatctctatatatgaattagatgtacttaacaagtaacaacgatgtacatattgttccctc |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38295417 |
tattgattgaatttggatctaattgtcatccctatatatgaattagatgcacttaacaagtaacaacgatgtatatattgttccctc |
38295503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 285 - 371
Target Start/End: Original strand, 38295567 - 38295653
Alignment:
| Q |
285 |
cttacacgtattttccaggatttatgtgaattttaacccaatgatcannnnnnnnnnnnattgaatcaatggcaggctgaatctttt |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38295567 |
cttacacgtattttccaggatttatgtgaattttaacccaatgatcatttttgttttttattgaatcaatggcaggctgaatctttt |
38295653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 285 - 331
Target Start/End: Original strand, 38302855 - 38302901
Alignment:
| Q |
285 |
cttacacgtattttccaggatttatgtgaattttaacccaatgatca |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38302855 |
cttacacgtattttccaggatttatgtgaattttaacccaatgatca |
38302901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 285 - 329
Target Start/End: Original strand, 38307066 - 38307110
Alignment:
| Q |
285 |
cttacacgtattttccaggatttatgtgaattttaacccaatgat |
329 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
38307066 |
cttacacatattttccaggatttatgtgaatcttaacccactgat |
38307110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University