View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_91 (Length: 366)
Name: NF0928_high_91
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_high_91 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 42038754 - 42038526
Alignment:
Q |
1 |
atcagacacgtacttagtgtggttgtacctttgacattgccatgaccatagatgtgcaattgatccaacggtggaggaagctgtgatggatgacaattgt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42038754 |
atcagacacgtacttagtgtggttgtacctttgacattgccatgaccatagatgtgcaattgatccaacggtggaggaagctgtgatggatgacaattgt |
42038655 |
T |
 |
Q |
101 |
catagtatggccaagatgcaatggagttgcagcagatgtaggtgtatggtacacctgattcctcaatcacacgtctaaccaaacgtttctgtttgtacat |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42038654 |
catagtatggccaagatgcaatggagttgcagcagatgtaggtgtatggtacacctgattcctcaatcacacgtctaaccaaacgtttctgtttgtacat |
42038555 |
T |
 |
Q |
201 |
tgctaggcctggctccacaggttctgctc |
229 |
Q |
|
|
||| ||||||||||||||||| ||||||| |
|
|
T |
42038554 |
tgcaaggcctggctccacaggatctgctc |
42038526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 675 times since January 2019
Visitors: 6718