View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_93 (Length: 365)
Name: NF0928_high_93
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_high_93 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 84 - 235
Target Start/End: Original strand, 42038845 - 42038996
Alignment:
| Q |
84 |
cttagtcagtgtgatactgaacatgtaccgattctttgtcacacatcaatcataataatatcatattagtattaatttaacatatagaatgtgattgatt |
183 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038845 |
cttagtcactgtgatactgaacatgtaccgattctttgtcacacatcaatcataataatatcatattagtattaatttaacatatagaatgtgattgatt |
42038944 |
T |
|
| Q |
184 |
gtgcagcttactttgttgatggctatgatattggcaagttcacaatgaaggt |
235 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038945 |
gtgcagcgtactttgttgatggctatgatattggcaagttcacaatgaaggt |
42038996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 42038730 - 42038840
Alignment:
| Q |
1 |
caaccacactaagtacgtgtctgatatcacggtggttttgccagaatcacgttgagcccatgtgattgtggcaaagtcactcacttagtcagtgtgatac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| || ||||| |
|
|
| T |
42038730 |
caaccacactaagtacgtgtctgatatcacagtggttttgccagaatcacgttgagccgatgtgattgtggcaaagtcactgacttagtcactgggatac |
42038829 |
T |
|
| Q |
101 |
tgaacatgtac |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
42038830 |
tgaacatgtac |
42038840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 996 times since January 2019
Visitors: 6719