View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_104 (Length: 369)
Name: NF0928_low_104
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_low_104 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 30 - 318
Target Start/End: Original strand, 43997172 - 43997461
Alignment:
Q |
30 |
tgagtatcctaagttggttggctttcatggatgactcatgcttcaatatcttgagttgcataggtttcttaagtatcttggacatcttcaataaccttt- |
128 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43997172 |
tgagtatcctaagttggttgggtttcatggatgactcatgcttcaatatcttgagctgcataggtttcttaagtatcttggacatcttcaataaccttta |
43997271 |
T |
 |
Q |
129 |
gcaccttcattagtttgaacatttgctttaatgcgttctttaactgtactggaattctgatgtgtatcttaaacatttgcaatcgaggagtctttcacat |
228 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||| ||||||||||||||||||||||||||| |||| |
|
|
T |
43997272 |
gcaccttcattagtttgaacatttgctttaatgtgttctttaactgtactggaattcagacgtgtattttaaacatttgcaatcgaggagtcttttacat |
43997371 |
T |
 |
Q |
229 |
atatttcctcaacgctcgataaatcaatttcaacatgtctttccatttcagatgtctccatatttttctttctattctcagtataatcta |
318 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| || |||||| |
|
|
T |
43997372 |
atatttcctcaacgctcgataaatcaatttcgacatgtctttccatttcagatatctccatatttttctttctattctcaatagaatcta |
43997461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University