View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_105 (Length: 368)
Name: NF0928_low_105
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_105 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 108 - 359
Target Start/End: Complemental strand, 40103534 - 40103284
Alignment:
| Q |
108 |
ccaacaatggagtggcaaaacaccaccttacggcgccgcagtaagcaactcgcaacgacaacaacctcctccttcacaggttagggttatcaacaatttt |
207 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40103534 |
ccaacaatggagtggcaa--caccaccttacggcgccgcagtaagcaactcgcaacgacaacaacctcctccttcacaggttagggttatcaacaatttt |
40103437 |
T |
 |
| Q |
208 |
tctccttttccgcatattcatcatttttctctacactttcgatttaaaacaggggaaacacttatattc-ttcgacatccgaaaatgtcaaggtgcatac |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||||||| |
|
|
| T |
40103436 |
tctccttttccgcatattcatcatttttctctacactttcgatttaaaacaggggaaacacttattttctttcgatcaccgaaaatgtcaaggtgcatac |
40103337 |
T |
 |
| Q |
307 |
caatggatcaactaaatcttgccacattccacaccattccctgttgcctatgc |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40103336 |
caatggatcaactaaatcttgccacattccacaccattccctgttgccaatgc |
40103284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University