View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_low_110 (Length: 365)

Name: NF0928_low_110
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_low_110
NF0928_low_110
[»] chr1 (2 HSPs)
chr1 (84-235)||(42038845-42038996)
chr1 (1-111)||(42038730-42038840)


Alignment Details
Target: chr1 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 84 - 235
Target Start/End: Original strand, 42038845 - 42038996
Alignment:
84 cttagtcagtgtgatactgaacatgtaccgattctttgtcacacatcaatcataataatatcatattagtattaatttaacatatagaatgtgattgatt 183  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42038845 cttagtcactgtgatactgaacatgtaccgattctttgtcacacatcaatcataataatatcatattagtattaatttaacatatagaatgtgattgatt 42038944  T
184 gtgcagcttactttgttgatggctatgatattggcaagttcacaatgaaggt 235  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||    
42038945 gtgcagcgtactttgttgatggctatgatattggcaagttcacaatgaaggt 42038996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 42038730 - 42038840
Alignment:
1 caaccacactaagtacgtgtctgatatcacggtggttttgccagaatcacgttgagcccatgtgattgtggcaaagtcactcacttagtcagtgtgatac 100  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| || |||||    
42038730 caaccacactaagtacgtgtctgatatcacagtggttttgccagaatcacgttgagccgatgtgattgtggcaaagtcactgacttagtcactgggatac 42038829  T
101 tgaacatgtac 111  Q
    |||||||||||    
42038830 tgaacatgtac 42038840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 483 times since January 2019
Visitors: 6717