View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_116 (Length: 360)
Name: NF0928_low_116
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_116 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 96 - 349
Target Start/End: Original strand, 26912572 - 26912817
Alignment:
| Q |
96 |
aacaaaaataagacagtgtaaaagctctttgcactggtagcgtatatgaattgattcattagatttttaaggacgcaatttcttgttttatttggacagg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26912572 |
aacaaaaataagacagtgtaaaagctctttgcactggtagcgtatatgaattgattcattagatttttaaggacgcaatttcttgttttatttggacagg |
26912671 |
T |
|
| Q |
196 |
agagtgagttttggtatgaaatgaactagagtaagaaactaagagtctttatcgtgctggaaaagattattgcgtctaagttatccagatattttttatt |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
26912672 |
agagtgagttttggtatgaaatgaactagagtaagaa--------tctttatcgtgctggaaaagatgattgcatctaagttatccagatattttttatt |
26912763 |
T |
|
| Q |
296 |
ttgggttgtgttagatttaatgttgtccaaataattatttttcctttgtcctat |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26912764 |
ttgggttgtgttagatttaatgttgtccaaataattatttttcctttgtcctat |
26912817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 647 times since January 2019
Visitors: 6718