View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_120 (Length: 354)
Name: NF0928_low_120
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_low_120 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 28 - 236
Target Start/End: Original strand, 490098 - 490306
Alignment:
Q |
28 |
caagttggaattagaggtgctggtgagatgagggtctatgcttcagagaaaccaagggcttgtggaattgatggcaaagaagttgattttgaatataaag |
127 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
490098 |
caagttggaattagaggtgctggtgagatgagggtctatgcttcagagaaaccaagggcttgtggaattgatggcaaagaagttgattttgaatataaag |
490197 |
T |
 |
Q |
128 |
agttcatggttgtgattcaaataccatggcctacttcttcaaaatggtcctttgttcagtatatattctgagcataggatgaagattattgaaactttca |
227 |
Q |
|
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
490198 |
agttcatggttgtgattcaagtaccatggcctagttcttcaaaatggtcctttgttcagtatatattctgagcataggatgaagattattgaaactttca |
490297 |
T |
 |
Q |
228 |
aacttatga |
236 |
Q |
|
|
||||||||| |
|
|
T |
490298 |
aacttatga |
490306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University