View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_128 (Length: 346)
Name: NF0928_low_128
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_128 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 89 - 306
Target Start/End: Original strand, 43576956 - 43577174
Alignment:
| Q |
89 |
cacatcttgtggccactcggctcaactcatcatgaattcactttgggtccaaataatctaaaaaatatatggattcttttttctcactttgaacactagt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43576956 |
cacatcttgtggccactcggctcaactcatcatgaattcactttgggtccaaataatctaaaaaatatatggattcttttttctcactttgaacactagt |
43577055 |
T |
 |
| Q |
189 |
agcacgtaacaggtcgagctaaattttgtaaagtttaattatggtttgat-nnnnnnnnnnnnnnnngttaaatctcaagtctaacatgttacctaacaa |
287 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43577056 |
agcacataataggtcgagctaaattttgtaaagtttaattatggtttgataaaaaagaaaaaaaaaagttaaatctcaagtctaacatgttacctaacaa |
43577155 |
T |
 |
| Q |
288 |
gtttattttgaagtttaat |
306 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
43577156 |
gtttattttgaagtttaat |
43577174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University