View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_129 (Length: 345)
Name: NF0928_low_129
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_129 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 36 - 345
Target Start/End: Complemental strand, 7949763 - 7949455
Alignment:
| Q |
36 |
tattattatggctgttgaaattgcttttgataaaaactggcatcacctttggatagagactgactccaagatagctaccttggccatcaagtcaccctct |
135 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7949763 |
tattattatggctgttgaaattgtttttgataaaaaatggcatcacctttggatagagactgactccaagatagctacgttggccatcaagtcaccctct |
7949664 |
T |
 |
| Q |
136 |
atagttccttggaaattaaagaatagatggaacaactgtgttggaaagcttcaatctatgcaattcatcctgtctcatatttacagagaaggaaatcact |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
7949663 |
atagttccttggaaattaaagaatagatggaacaactgtgttggaaagcttcaatctatgcaattcatcttgtctcatatttacagagaagaaaatcatc |
7949564 |
T |
 |
| Q |
236 |
gtgctgacaaacttgcaaacttaggcttatctattgttgatttcacttggtggtcctttccttcaattgtaattagaggggacctaggtaggaacaagct |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
7949563 |
gtgctgacaaacttgcaaacttaggcttatctattgctgatttcactt-gtggtcctttcctccaattataattagaggggacctaggtaggaataagct |
7949465 |
T |
 |
| Q |
336 |
aggtcttccc |
345 |
Q |
| |
|
|||||||||| |
|
|
| T |
7949464 |
aggtcttccc |
7949455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 6 - 39
Target Start/End: Original strand, 34742774 - 34742807
Alignment:
| Q |
6 |
attaatgttctactttacttaaataaaggatatt |
39 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
34742774 |
attaatgttctactttacttaaatataggatatt |
34742807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University