View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_131 (Length: 343)
Name: NF0928_low_131
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_131 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 31 - 312
Target Start/End: Complemental strand, 42332585 - 42332316
Alignment:
| Q |
31 |
tcctaacatagttaatggccctttgcctacctctaactggttctcagatggtgtggtgaaagtggtcgagatgggtaattgagtttattttggttagatg |
130 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42332585 |
tcctaacatagttaatggcccttggcctacctctaactggttctcagatggtgtggtgaaagtggtcgagatgggtaattgagtttattttggttagatg |
42332486 |
T |
|
| Q |
131 |
tttgggtaagaaatttaggttttggggaagaggtggatttgaatgctctcttggaggagacctctttctttctatctgggatcaacttttgttggaaaat |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42332485 |
tttgggtaagaaatttaggttttggggaagaggtggatttgaatgctctcttggaggagacctcttt---------tgggatcaacttttgttggaaaaa |
42332395 |
T |
|
| Q |
231 |
ttgatgaagctcattggtggtgtaaccttgactcatgagggagaaaggtggtcttggattaacgactcttccgatcattcat |
312 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||||||||||||||| | |||||||||||| ||||||||| |
|
|
| T |
42332394 |
ttgatgaagc---ttggtggtgtaaccttgactcctgagggagaaaggtggtcttgggtgaacgactcttccaatcattcat |
42332316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 926 times since January 2019
Visitors: 6707