View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_134 (Length: 340)
Name: NF0928_low_134
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_134 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 303; Significance: 1e-170; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 1 - 311
Target Start/End: Complemental strand, 52423081 - 52422771
Alignment:
| Q |
1 |
ggttattagacctaagaggttggtgattaaattcgacccaatttttcgcattattaagaatttaaacaaaagcactcgtgggaacacataatattggatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52423081 |
ggttattagacctaagaggttggtgattaaattcgacccaatttttcgcattattaagaatttaaacaaaagcactcgtgggaacacataatattggatt |
52422982 |
T |
 |
| Q |
101 |
tctgttgtaatttagaattgaacatgcagtgtctcccaatataagtaacttgcattataaatgataactaacgttttttctttcctgtattattgaagga |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52422981 |
tctgttgtaatttagaattgaatatgcagtgtctcccaatataagtaacttgccttataaatgataactaacgttttttctttcctgtattattgaagga |
52422882 |
T |
 |
| Q |
201 |
gtcaaatcttaaatcaatgtaatgatcactacaccaaaatattgttaaataaactcaaaagcttgtcactatttctcacgttttgatttattaaaacaac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52422881 |
gtcaaatcttaaatcaatgtaatgatcactacaccaaaatattgttaaataaactcaaaagcttgtcactatttctcacgttttgatttattaaaacaac |
52422782 |
T |
 |
| Q |
301 |
atatttcctag |
311 |
Q |
| |
|
||||||||||| |
|
|
| T |
52422781 |
atatttcctag |
52422771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 42715983 - 42715940
Alignment:
| Q |
1 |
ggttattagacctaagaggttggtgattaaattcgacccaatttt |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42715983 |
ggttattagacctaagaggttggtgattaaatt-gacccaatttt |
42715940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 129 - 165
Target Start/End: Complemental strand, 42715529 - 42715493
Alignment:
| Q |
129 |
gtgtctcccaatataagtaacttgcattataaatgat |
165 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42715529 |
gtgtctcccaatataagtaatttgcattataaatgat |
42715493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University