View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_137 (Length: 338)
Name: NF0928_low_137
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_low_137 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 24 - 284
Target Start/End: Complemental strand, 22619290 - 22619030
Alignment:
Q |
24 |
catcaatgtgtcagttacttccattatctataagaaatcctctttcttgacgtaaagcaccattccactattgttcttcagactttattaccgtaaagat |
123 |
Q |
|
|
||||||||| ||| |||||||||||||||||||||| ||||||||||||| |||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
22619290 |
catcaatgtctcaattacttccattatctataagaac-cctctttcttgacataaaaaaccattccactattgtccttcagactttattaccgtaaagat |
22619192 |
T |
 |
Q |
124 |
agctgttttt-ggggtctgagatctcttcaccttccaagaaacgtctcgttgtcatcgccgacttgtcgacaagaaagctgcattcagattgcttccaac |
222 |
Q |
|
|
|||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||| |
|
|
T |
22619191 |
agctgttttttggggtctgagatctcttcaccttcaaagaaacgtctcgttgtcatcgccgacttgtcgacaagaaaacaacattcagattgcttcgaac |
22619092 |
T |
 |
Q |
223 |
aaattatctgaggtttttggctcatgattcgcctaatgcaacaaaggacatgttcatgcaaa |
284 |
Q |
|
|
|||||||||||||||||| |||||||||| |||| |||||||||||||||||||||||||| |
|
|
T |
22619091 |
aaattatctgaggtttttagctcatgattatcctagtgcaacaaaggacatgttcatgcaaa |
22619030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 119 - 252
Target Start/End: Original strand, 17528531 - 17528663
Alignment:
Q |
119 |
aagatagctgtttttggggtctgagatctcttcaccttccaagaaacgtctcgttgtcatcgccgacttgtcgacaagaaagctgcattcagattgcttc |
218 |
Q |
|
|
|||||||||||||||||| || ||||| |||||| |||| || ||| |||||||||||| | ||||| ||||||||| | | ||||||||||||| |
|
|
T |
17528531 |
aagatagctgtttttgggatcagagatatcttcaacttcaaaaaaaa-tctcgttgtcatttacagcttgtggacaagaaaaccactttcagattgcttc |
17528629 |
T |
 |
Q |
219 |
caacaaattatctgaggtttttggctcatgattc |
252 |
Q |
|
|
||||||| |||||||||||||| ||| ||||||| |
|
|
T |
17528630 |
caacaaaatatctgaggttttttgctgatgattc |
17528663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 48084686 - 48084719
Alignment:
Q |
299 |
gtgtgtcactttcaaacatgtctagtataatcta |
332 |
Q |
|
|
|||||||||||||||||||||||||||| ||||| |
|
|
T |
48084686 |
gtgtgtcactttcaaacatgtctagtattatcta |
48084719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1326 times since January 2019
Visitors: 6712