View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_138 (Length: 337)
Name: NF0928_low_138
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_low_138 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 8e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 215 - 317
Target Start/End: Complemental strand, 36753815 - 36753713
Alignment:
Q |
215 |
agtctttcgtgaaagtcagggatgtgtcacttttcttcttgttggcactggtagtggtagtagtaaataattccctcattttcacgtagctatgctttaa |
314 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36753815 |
agtctttcgtgaaagtcagggatgtgtcacttttcttcttgttggcactggtagtagtagtagtaaataattccctcattttcacgtagctatgctttaa |
36753716 |
T |
 |
Q |
315 |
cac |
317 |
Q |
|
|
||| |
|
|
T |
36753715 |
cac |
36753713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 28216219 - 28216087
Alignment:
Q |
1 |
ttatgatgagtgagtacttcttctagaacaaggaaattatttgataaggttttcattagtgaagaattggagattaaattttaataaggagaaaaaagag |
100 |
Q |
|
|
|||||||||||||||| ||| |||||||| ||||| ||| ||| ||| ||| ||| ||||||||||||||| |||||||||||||| ||||||||||| |
|
|
T |
28216219 |
ttatgatgagtgagtagttcccctagaacatggaaagtatatgacaagttttccataagtgaagaattggagtttaaattttaataatgagaaaaaagat |
28216120 |
T |
 |
Q |
101 |
gcatatgttgagaagataaataatctcttaaag |
133 |
Q |
|
|
||||||||| ||||||||||||||| ||||||| |
|
|
T |
28216119 |
gcatatgtttagaagataaataatcccttaaag |
28216087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University