View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_143 (Length: 334)
Name: NF0928_low_143
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_143 |
 | |
|
| [»] scaffold0536 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 132 - 271
Target Start/End: Original strand, 2832845 - 2832984
Alignment:
| Q |
132 |
gattgagccgccaatgtgaatggaaacagaagacaatgcacgtatgtcagtcagggttatgataacaaagatgttacgttattttattattgattgatag |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2832845 |
gattgagccgccaatgtgaatggaaacagaagaaaatgcacgtatgtcagtcagggttatgataacaaagatgttacgttattttattattgattgatag |
2832944 |
T |
|
| Q |
232 |
atgatgataggaagatgtatattccagaaaccagatctgt |
271 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2832945 |
ataatgataggaagatgtatattccagaaaccagatctgt |
2832984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 30 - 95
Target Start/End: Original strand, 2832739 - 2832804
Alignment:
| Q |
30 |
attgggtaggtaacaaattatttaatcggtcaactcaccccattttatgtaacatttaatttaagt |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2832739 |
attgggtaggtaacaaattatttaatcggtcaactcaccccattttatgtaacatttaatttaagt |
2832804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 271 - 332
Target Start/End: Original strand, 48912702 - 48912763
Alignment:
| Q |
271 |
tgctcgagagtttggggagaaagctaaacatgcaattaaagaaggtggttcatctcactcga |
332 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48912702 |
tgctcgagagtttggggagaaagctaaacatgcaattaaagaaggtggttcatctcattcga |
48912763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0536 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0536
Description:
Target: scaffold0536; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 271 - 327
Target Start/End: Original strand, 6868 - 6924
Alignment:
| Q |
271 |
tgctcgagagtttggggagaaagctaaacatgcaattaaagaaggtggttcatctca |
327 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| | ||||||||||||||||||| |
|
|
| T |
6868 |
tgctcgagagtttggggataaggctaaacatgcggctcaagaaggtggttcatctca |
6924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 523 times since January 2019
Visitors: 6704