View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_145 (Length: 331)
Name: NF0928_low_145
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_low_145 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 29 - 315
Target Start/End: Complemental strand, 44559897 - 44559611
Alignment:
Q |
29 |
aaaatatagccgagggatacttgaggagaggcattgttgctaaaccctcagattatttatttgcaaagtaatggttagcacttggactagtattagtcat |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44559897 |
aaaatatagccgagggatacttgaggagaggcattgttgctaaaccctcagattatttatttgcaaagtaatggttagcacttggactagtattagtcat |
44559798 |
T |
 |
Q |
129 |
tctgagtcggtgatgtgcgatcagttaatgtctggagaaaacaaatcacaaatgacaggtggcaacattattttagctgattgcatggtgcaagttcacg |
228 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44559797 |
tctgagtcggtgatgtgcgatcagttaatgtttggagaaaacaaatcacaaatgacaggtggcaacattattttagctgattgcatggtgcaagttcacg |
44559698 |
T |
 |
Q |
229 |
atgacattagaaaatggataatctctgatttggtcggtatggagatggcaattggaaggtgaatattttgatggtgtagatgtgaga |
315 |
Q |
|
|
||||||| |||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44559697 |
atgacatgagaaaatggatagtctctgatttggtcgatatggagatggcaattggaaggtgaatattttgatggtgtagatgtgaga |
44559611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 97 times since January 2019
Visitors: 6713