View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_150 (Length: 325)
Name: NF0928_low_150
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_150 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 94 - 296
Target Start/End: Original strand, 735616 - 735818
Alignment:
| Q |
94 |
agaatagttttctacgatgaagctgatgataacgatatgtgggtgatttgtccgttcaagaattgctcaggttatctcttgaatgatgggtttcaaactg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
735616 |
agaatagttttctacgatgaagctgatgataacgatatgtgggtgatttgtccgttcaagaattgctcaggttatctcttgaatgatgggtttcaaactg |
735715 |
T |
 |
| Q |
194 |
ttattgatgcagattgccccatttgtcataggttattctgctcgcgatgcaaagttccttggcatgcaggtgaaacctgtcaacaattccaacacaacaa |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
735716 |
ttattgatgcagattgccccatttgtcataggttattctgctcgcgatgcaacgttccttggcatgcaggtgaaacctgtcaacaattccaacacaacaa |
735815 |
T |
 |
| Q |
294 |
act |
296 |
Q |
| |
|
||| |
|
|
| T |
735816 |
act |
735818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 9 - 69
Target Start/End: Original strand, 735540 - 735600
Alignment:
| Q |
9 |
agcagagaagctagtttccgtcataggtcactggctaccgttcccgttccgacgagagcag |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
735540 |
agcagagaagctagtttccgtcataggtcactggctaccgttcccgttccgacgagagcag |
735600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 9 - 58
Target Start/End: Original strand, 732389 - 732438
Alignment:
| Q |
9 |
agcagagaagctagtttccgtcataggtcactggctaccgttcccgttcc |
58 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||| | ||||| ||||||| |
|
|
| T |
732389 |
agcagagaagctagtttccgtaataggtcattggtttccgttaccgttcc |
732438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University