View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_low_150 (Length: 325)

Name: NF0928_low_150
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_low_150
NF0928_low_150
[»] chr5 (3 HSPs)
chr5 (94-296)||(735616-735818)
chr5 (9-69)||(735540-735600)
chr5 (9-58)||(732389-732438)


Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 94 - 296
Target Start/End: Original strand, 735616 - 735818
Alignment:
94 agaatagttttctacgatgaagctgatgataacgatatgtgggtgatttgtccgttcaagaattgctcaggttatctcttgaatgatgggtttcaaactg 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
735616 agaatagttttctacgatgaagctgatgataacgatatgtgggtgatttgtccgttcaagaattgctcaggttatctcttgaatgatgggtttcaaactg 735715  T
194 ttattgatgcagattgccccatttgtcataggttattctgctcgcgatgcaaagttccttggcatgcaggtgaaacctgtcaacaattccaacacaacaa 293  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
735716 ttattgatgcagattgccccatttgtcataggttattctgctcgcgatgcaacgttccttggcatgcaggtgaaacctgtcaacaattccaacacaacaa 735815  T
294 act 296  Q
    |||    
735816 act 735818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 9 - 69
Target Start/End: Original strand, 735540 - 735600
Alignment:
9 agcagagaagctagtttccgtcataggtcactggctaccgttcccgttccgacgagagcag 69  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
735540 agcagagaagctagtttccgtcataggtcactggctaccgttcccgttccgacgagagcag 735600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 9 - 58
Target Start/End: Original strand, 732389 - 732438
Alignment:
9 agcagagaagctagtttccgtcataggtcactggctaccgttcccgttcc 58  Q
    ||||||||||||||||||||| |||||||| ||| | ||||| |||||||    
732389 agcagagaagctagtttccgtaataggtcattggtttccgttaccgttcc 732438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University