View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_156 (Length: 319)
Name: NF0928_low_156
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_low_156 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 6e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 102 - 235
Target Start/End: Complemental strand, 28664442 - 28664309
Alignment:
Q |
102 |
tatatttatattacatcaaatactatattgcaagtcaatcatcatgcatgatacaacttgataatacactcacaaacttcaaaggtgaattattttctat |
201 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28664442 |
tatatttatattacatcaaatactatattgcaagtcaatcatcatgcatgatacaacttgataatacactcacaaacttcaaaggtgaattattttctat |
28664343 |
T |
 |
Q |
202 |
tacctttgtcggctgatcaagtaacatatctgtg |
235 |
Q |
|
|
| |||||||||||||||||||||| ||||||||| |
|
|
T |
28664342 |
tgcctttgtcggctgatcaagtaaaatatctgtg |
28664309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University