View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_166 (Length: 316)
Name: NF0928_low_166
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_166 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 54 - 316
Target Start/End: Original strand, 32266852 - 32267114
Alignment:
| Q |
54 |
gattgagtatcctcctccatcatagccttgttgatctttttctctttctcagaatgagaagccatgtgtccacaaagtgctttcaatgaaggaaaacctt |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32266852 |
gattgagtatcctcctccatcatagccttgttgatctttttctctttctcagaatgagaagccatgtgtccacaaagtgctttcaatgaaggaaaacctt |
32266951 |
T |
 |
| Q |
154 |
tcccacattctttgcagaatttgatcatttcattttgttccaatgtggttnnnnnnnnnnnnnnnnnntgatgattataatgatgatgatgagaatgcac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32266952 |
tcccacattctttgcagaatttgatcatttcattttgttccaatgtggttgcagcagcagtagcagcatgatgattataatgatgatgatgagaatgcac |
32267051 |
T |
 |
| Q |
254 |
aaacctcattgttttcttgggattttctcttagaccataaatgaggtttccaccatcaccaac |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32267052 |
aaacctcattgttttcttgggattttctcttagaccataaatgaggtttccaccatcaccaac |
32267114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 96 - 175
Target Start/End: Original strand, 19301397 - 19301476
Alignment:
| Q |
96 |
tctttctcagaatgagaagccatgtgtccacaaagtgctttcaatgaaggaaaacctttcccacattctttgcagaattt |
175 |
Q |
| |
|
||||||||||| ||| |||||||||| ||||| |||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
19301397 |
tctttctcagagtgacaagccatgtgaccacacagtgctttcaatgatggaaaaccttttccacattctttgcagaattt |
19301476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 249 - 314
Target Start/End: Original strand, 19301508 - 19301573
Alignment:
| Q |
249 |
tgcacaaacctcattgttttcttgggattttctcttagaccataaatgaggtttccaccatcacca |
314 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||| ||||||||||| ||||| ||| |||||||| |
|
|
| T |
19301508 |
tgcacaaacctagttgttttcttgggattctctctaagaccataaataaggttaccatcatcacca |
19301573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University