View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_179 (Length: 301)
Name: NF0928_low_179
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_low_179 |
 |  |
|
[»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 301
Target Start/End: Original strand, 16910461 - 16910761
Alignment:
Q |
1 |
tcgtgacaaatcaatttctttacaagatattgttttaagaaatgaaggaggcgttgaacctgaacttgtggacatggtcatgaaatatgcgatgtcacat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||||||||| ||||||||| |
|
|
T |
16910461 |
tcgtgacaaatcaatttctttacaagatattgttttaagaaatgaaagaggcgttgaacctaaacttgtggacgcggtcatgaaatatgctatgtcacat |
16910560 |
T |
 |
Q |
101 |
aatgtcgagaatttcactcttgaactttatttgaatttcaaacccggttacattttgcgccctagcatcttttcttgcaaatctttgacacatctaaagc |
200 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16910561 |
aatgtcgagaatttcacacttgaactttatttgaatttcaaacccggttacactttgcgccctagcatcttttcttgcaaatctttgacacatctaaagc |
16910660 |
T |
 |
Q |
201 |
ttttattttggggtgtccgttggatgatgaaaattccaacttccttggaattgcctgctttgaaaagcttgcatcttatctctgtcacttttgttgcaaa |
300 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
16910661 |
ttttattttggggtgtcccttggatgatgaaaattccaacttccttggaattgcctgctttgaaaagcttgcatcttatctctgccacttttgttgcaaa |
16910760 |
T |
 |
Q |
301 |
t |
301 |
Q |
|
|
| |
|
|
T |
16910761 |
t |
16910761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 110 - 203
Target Start/End: Complemental strand, 50790383 - 50790290
Alignment:
Q |
110 |
aatttcactcttgaactttatttgaatttcaaacccggttacattttgcgccctagcatcttttcttgcaaatctttgacacatctaaagcttt |
203 |
Q |
|
|
||||| ||||||||| || ||| |||||| || | |||||||| |||| |||||||||||||||||| ||||||||||| ||| ||||||| |
|
|
T |
50790383 |
aatttaactcttgaagttgattcgaattttaagcgcggttacacattgcaccctagcatcttttcttgtcaatctttgacatgtcttaagcttt |
50790290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University