View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_low_180 (Length: 299)

Name: NF0928_low_180
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_low_180
NF0928_low_180
[»] chr1 (1 HSPs)
chr1 (30-285)||(33523360-33523618)


Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 30 - 285
Target Start/End: Complemental strand, 33523618 - 33523360
Alignment:
30 ataagtagttggaggatgagatcctcaacatgttaatttcaaaaatcatgtattaaaaggctcaaaatttaggaaacgatcatctcggaaagaggatgga 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33523618 ataagtagttggaggatgagatcctcaacatgttaatttcaaaaatcatgtattaaaaggctcaaaatttaggaaacgatcatctcggaaagaggatgga 33523519  T
130 attaatgttgccatcgttgtggaatttcaaattccacaaggaagaagaaagagaagggatggatgcttgcat---gttgagtaatgaaaaacacaaatat 226  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||    
33523518 attaatgttgccatcgttgtggaatttcaaattccacaaggaagaagaaagagaagggatggatgcttgcatgttgttgagtaatgaaaaacacaaatat 33523419  T
227 ggatggttttcaacccaaaatatgtgattttgtgatttttgaatctcttgctcctatga 285  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33523418 ggatggttttcaacccaaaatatgtgattttgtgatttttgaatctcttgctcctatga 33523360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 739 times since January 2019
Visitors: 6719