View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_187 (Length: 293)
Name: NF0928_low_187
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_187 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 11)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 72 - 260
Target Start/End: Complemental strand, 31683149 - 31682961
Alignment:
| Q |
72 |
tcccaatctagtatcttttgatgttacacgggtgcataagggtgattttccattggaatgttttgaaataagagattgccctggattgacgtctttccca |
171 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31683149 |
tcccaatctagtatcttttgatgttacaggggtgcataagggtgattttccattggaatgttttgaaataagagattgccctggattgacgtctttccca |
31683050 |
T |
|
| Q |
172 |
gatgaaggatttcatacaccaaacctacatgccttcacccttttcaattgcaagaatcttaaaaaattccccaattttattgcctctct |
260 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31683049 |
gatgaaggatttcatacaccaaacctacgtgccttcaccctttccaattgcaagaatcttaaaaaattccccaattttattgcctctct |
31682961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 72 - 260
Target Start/End: Original strand, 31895283 - 31895471
Alignment:
| Q |
72 |
tcccaatctagtatcttttgatgttacacgggtgcataagggtgattttccattggaatgttttgaaataagagattgccctggattgacgtctttccca |
171 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31895283 |
tcccaatctagtatcttttgatgttacaggggtgcataagggtgattttccattggaatgttttgaaataagagattgccctggattgacgtctttccca |
31895382 |
T |
|
| Q |
172 |
gatgaaggatttcatacaccaaacctacatgccttcacccttttcaattgcaagaatcttaaaaaattccccaattttattgcctctct |
260 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31895383 |
gatgaaggatttcatacaccaaacctacgtgccttcaccctttccaattgcaagaatcttaaaaaattccccaattttattgcctctct |
31895471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 72 - 260
Target Start/End: Original strand, 31899867 - 31900055
Alignment:
| Q |
72 |
tcccaatctagtatcttttgatgttacacgggtgcataagggtgattttccattggaatgttttgaaataagagattgccctggattgacgtctttccca |
171 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31899867 |
tcccaatctagtatcttttgatgttacaggggtgcataagggtgattttccattggaatgttttgaaataagagattgccctggattgacgtctttccca |
31899966 |
T |
|
| Q |
172 |
gatgaaggatttcatacaccaaacctacatgccttcacccttttcaattgcaagaatcttaaaaaattccccaattttattgcctctct |
260 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31899967 |
gatgaaggatttcatacaccaaacctacgtgccttcaccctttccaattgcaagaatcttaaaaaattccccaattttattgcctctct |
31900055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 72 - 260
Target Start/End: Original strand, 31915576 - 31915764
Alignment:
| Q |
72 |
tcccaatctagtatcttttgatgttacacgggtgcataagggtgattttccattggaatgttttgaaataagagattgccctggattgacgtctttccca |
171 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31915576 |
tcccaatctagtatcttttgatgttacaggggtgcataagggtgattttccattggaatgttttgaaataagagattgccctggattgacgtctttccca |
31915675 |
T |
|
| Q |
172 |
gatgaaggatttcatacaccaaacctacatgccttcacccttttcaattgcaagaatcttaaaaaattccccaattttattgcctctct |
260 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31915676 |
gatgaaggatttcatacaccaaacctacgtgccttcaccctttccaattgcaagaatcttaaaaaattccccaattttattgcctctct |
31915764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 72 - 260
Target Start/End: Original strand, 31949224 - 31949412
Alignment:
| Q |
72 |
tcccaatctagtatcttttgatgttacacgggtgcataagggtgattttccattggaatgttttgaaataagagattgccctggattgacgtctttccca |
171 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31949224 |
tcccaatctagtatcttttgatgttacaggggtgcataagggtgattttccattggaatgttttgaaataagagattgccctggattgacgtctttccca |
31949323 |
T |
|
| Q |
172 |
gatgaaggatttcatacaccaaacctacatgccttcacccttttcaattgcaagaatcttaaaaaattccccaattttattgcctctct |
260 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31949324 |
gatgaaggatttcatacaccaaacctacgtgccttcaccctttccaattgcaagaatcttaaaaaattccccaattttattgcctctct |
31949412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 72 - 260
Target Start/End: Complemental strand, 52652017 - 52651824
Alignment:
| Q |
72 |
tcccaatctagtatcttttgatgttacac-----gggtgcataagggtgattttccattggaatgttttgaaataagagattgccctggattgacgtctt |
166 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||||||||| | ||||| |||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
52652017 |
tcccaatctagtatcttttgatgttacagtacaggggtgtataagggtgattttgctttggagtgttttcaaataagagattgtcctggattgacgtctt |
52651918 |
T |
|
| Q |
167 |
tcccagatgaaggatttcatacaccaaacctacatgccttcacccttttcaattgcaagaatcttaaaaaattccccaattttattgcctctct |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||||| |||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
52651917 |
tcccagatgaaggatttcatacaccaaacctacataccttctccctttccaattgcaagaatcttcacaaattccccaattttattgcctctct |
52651824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 130 - 260
Target Start/End: Complemental strand, 16040186 - 16040056
Alignment:
| Q |
130 |
tgttttgaaataagagattgccctggattgacgtctttcccagatgaaggatttcatacaccaaacctacatgccttcacccttttcaattgcaagaatc |
229 |
Q |
| |
|
|||||||||| |||||||| ||||||||| ||||||| || |||||||||||||||||||| |||||||| |||||||||||| |||||||||||||| |
|
|
| T |
16040186 |
tgttttgaaactagagattgtcctggattggtgtctttcacacatgaaggatttcatacaccacacctacataccttcaccctttccaattgcaagaatc |
16040087 |
T |
|
| Q |
230 |
ttaaaaaattccccaattttattgcctctct |
260 |
Q |
| |
|
|| | |||||||||||||||||||||||||| |
|
|
| T |
16040086 |
ttcacaaattccccaattttattgcctctct |
16040056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 130 - 260
Target Start/End: Complemental strand, 16046691 - 16046561
Alignment:
| Q |
130 |
tgttttgaaataagagattgccctggattgacgtctttcccagatgaaggatttcatacaccaaacctacatgccttcacccttttcaattgcaagaatc |
229 |
Q |
| |
|
|||||||||| |||||||| ||| ||||| ||||||| || ||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
16046691 |
tgttttgaaactagagattgtcctagattggtgtctttcacacatgaaggatttcatacaccaaacctacataccttcaccctttccaattgcaagaatc |
16046592 |
T |
|
| Q |
230 |
ttaaaaaattccccaattttattgcctctct |
260 |
Q |
| |
|
|| | |||||||||||||||||||||||||| |
|
|
| T |
16046591 |
ttcacaaattccccaattttattgcctctct |
16046561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 130 - 260
Target Start/End: Complemental strand, 16062213 - 16062083
Alignment:
| Q |
130 |
tgttttgaaataagagattgccctggattgacgtctttcccagatgaaggatttcatacaccaaacctacatgccttcacccttttcaattgcaagaatc |
229 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||| || |||||||||||||||||||||||||| || | |||||||||| |||||||||||||| |
|
|
| T |
16062213 |
tgttttgaaactagagattgtcctggattgacgtctttcacacatgaaggatttcatacaccaaacctatatacattcaccctttccaattgcaagaatc |
16062114 |
T |
|
| Q |
230 |
ttaaaaaattccccaattttattgcctctct |
260 |
Q |
| |
|
|| | ||| |||||||||||||||||||||| |
|
|
| T |
16062113 |
ttcacaaactccccaattttattgcctctct |
16062083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 130 - 260
Target Start/End: Complemental strand, 16058068 - 16057938
Alignment:
| Q |
130 |
tgttttgaaataagagattgccctggattgacgtctttcccagatgaaggatttcatacaccaaacctacatgccttcacccttttcaattgcaagaatc |
229 |
Q |
| |
|
||||||||||| |||||||| ||||||||| ||||||| || |||||||||||||||||||| ||||| || ||| |||||||| |||||||||||||| |
|
|
| T |
16058068 |
tgttttgaaattagagattgtcctggattggtgtctttcacacatgaaggatttcatacaccacacctaaatacctccaccctttccaattgcaagaatc |
16057969 |
T |
|
| Q |
230 |
ttaaaaaattccccaattttattgcctctct |
260 |
Q |
| |
|
|| | |||||||||||||||||||||||||| |
|
|
| T |
16057968 |
ttcacaaattccccaattttattgcctctct |
16057938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 130 - 260
Target Start/End: Complemental strand, 16036107 - 16035977
Alignment:
| Q |
130 |
tgttttgaaataagagattgccctggattgacgtctttcccagatgaaggatttcatacaccaaacctacatgccttcacccttttcaattgcaagaatc |
229 |
Q |
| |
|
|||||||||| |||||||| ||| ||||| ||||||| || ||||||||||||||||||||||||||||| ||||||||||| |||||| || |||| |
|
|
| T |
16036107 |
tgttttgaaactagagattgtcctagattggtgtctttcacacatgaaggatttcatacaccaaacctacataacttcaccctttccaattgaaaaaatc |
16036008 |
T |
|
| Q |
230 |
ttaaaaaattccccaattttattgcctctct |
260 |
Q |
| |
|
|| | |||||||||||||||||||||||||| |
|
|
| T |
16036007 |
ttcacaaattccccaattttattgcctctct |
16035977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 949 times since January 2019
Visitors: 6707