View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_189 (Length: 291)
Name: NF0928_low_189
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_189 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 6 - 281
Target Start/End: Complemental strand, 47270739 - 47270466
Alignment:
| Q |
6 |
aattgttgactgcaacacaaatccaaatccaaattcgtaattccatatgttcttataccagtacatcatactgatacttattttatcctaatgttggtgg |
105 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47270739 |
aattgttgactgcaaca--aatccaaatccaaattcgtaattccatatgttcttataccagtacatcatactgatacttattttatcctaatgttggtgg |
47270642 |
T |
|
| Q |
106 |
tacctttgatttgtctgaacttttgttaccgtgcaactatgaaggatgcataatcaagaggtgagtagttcatttagccttgtatcattgtataatgttt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47270641 |
tacctttgatttgtctgaacttttgttaccgtgcaactatgaaggatgcataatcaagaggtgagtagttcatttagccttgtatcattgtataatgttt |
47270542 |
T |
|
| Q |
206 |
ttagtttgaactgaacatcaattttcaaatgttcttgggaatattgttttgaaattacaaattatgattgtctctg |
281 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47270541 |
ttagtttgaactgaacatcaatttacaaatgttcttgggaatattgttttgaaattacaaattatgattgtctctg |
47270466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1400 times since January 2019
Visitors: 6712