View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_198 (Length: 286)
Name: NF0928_low_198
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_198 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 34743125 - 34743346
Alignment:
| Q |
1 |
ttttccaattgatccaccatcacttgcatgcttaatctcaaccnnnnnnnatgtaagaaaggttttcttttcttatatttcatcaataagtaccatgaga |
100 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34743125 |
ttttccaattgatccaccatcaattgtatgcttaatctcaacctttttt-atgtaagaaaggttttcttttcttatatttcatcgataagtaccatgaga |
34743223 |
T |
|
| Q |
101 |
gtnnnnnnnnngttgtgttctatctattcaattttacagacaataatgtattttgaaccgattaatgagtgcacatgtattagatttgcttaatctaaca |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34743224 |
gtaaaaaaaaagttgtgttctatctattcaattttacagacaataatgtattttgaaccgattaatgagtgcacatgtattggatttgcttaatctaaca |
34743323 |
T |
|
| Q |
201 |
tgtatgcaaggtggaattgagag |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
34743324 |
tgtatgcaaggtggaattgagag |
34743346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 51 - 205
Target Start/End: Complemental strand, 29550010 - 29549858
Alignment:
| Q |
51 |
atgtaagaaaggt-tttcttttcttatatttcatcaataagtaccatgagagtnnnnnnnnngttgtgttctatctattcaattttacagacaataatgt |
149 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||| | || ||||||||||| | |||||||||||||| |||| | |||| ||||| |
|
|
| T |
29550010 |
atgtaagaaatgtgtttcttttcttatatttcatcattgagcaccatgagagtaaaaatt---tggtgttctatctattatatttgatgcacaacaatgt |
29549914 |
T |
|
| Q |
150 |
attttgaaccgattaatgagtgcacatgtattagatttgcttaatctaacatgtat |
205 |
Q |
| |
|
||||||||||||| ||||||| || |||| || ||||||||||||||| ||||||| |
|
|
| T |
29549913 |
attttgaaccgatgaatgagttcaaatgttttggatttgcttaatctaccatgtat |
29549858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1360 times since January 2019
Visitors: 6712