View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_202 (Length: 281)
Name: NF0928_low_202
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_202 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 249; Significance: 1e-138; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 9 - 281
Target Start/End: Complemental strand, 31128073 - 31127801
Alignment:
| Q |
9 |
agcacagattgaaataatttccattaaataataaaagtcataattttattcttaatttagacgagaaatgtaaactacaaaattacctacacaaccttag |
108 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31128073 |
agcacagattgatataatttccattaaataataaaagtcataattttattcttaatttagacgagaaatgtaaactacaaaattacctacacaaccttag |
31127974 |
T |
 |
| Q |
109 |
tttatgcataaaataagatttcattcatttgtgctgccacgcttctcaatctttaccgggaagccacctttcattatcgaagtaaggtgtgcagcgaact |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31127973 |
tttatgcataaaataagatttcattcatttgtgctgccacgcttctcaatctttaccaggaagccacctttcattatcgaagtaaggtgtgcagcgaact |
31127874 |
T |
 |
| Q |
209 |
ctggctcaacccctttatccattgcaggaaccaccctaaactgcctcataatcccagcaaccacccttctcat |
281 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |||| |
|
|
| T |
31127873 |
ccggctcaacccctttatccattgcaggaaccaccctaaactgcctcatgatcccggcaaccacccttttcat |
31127801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 148 - 275
Target Start/End: Complemental strand, 31078616 - 31078489
Alignment:
| Q |
148 |
cgcttctcaatctttaccgggaagccacctttcattatcgaagtaaggtgtgcagcgaactctggctcaacccctttatccattgcaggaaccaccctaa |
247 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||| | || |||||||||||| | |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31078616 |
cgcttctcaattcttaccgagaagccacctttcatcaatgaggtaaggtgtgcaatgtactccggctcaacccctttatccattgcaggaaccaccctaa |
31078517 |
T |
 |
| Q |
248 |
actgcctcataatcccagcaaccaccct |
275 |
Q |
| |
|
|||||||||| ||||| ||||||||||| |
|
|
| T |
31078516 |
actgcctcatgatccctgcaaccaccct |
31078489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 148 - 271
Target Start/End: Complemental strand, 31132645 - 31132522
Alignment:
| Q |
148 |
cgcttctcaatctttaccgggaagccacctttcattatcgaagtaaggtgtgcagcgaactctggctcaacccctttatccattgcaggaaccaccctaa |
247 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| || |||||||| |||| | | ||| |||| |||||||||| |||||| || |||| || ||||| |
|
|
| T |
31132645 |
cgcttcttgatctttaccggaaagccacctttcataattgaagtaagatgtgaatcaaacactggttcaaccccttcatccatcgctggaagcaacctaa |
31132546 |
T |
 |
| Q |
248 |
actgcctcataatcccagcaacca |
271 |
Q |
| |
|
||| ||| ||||| ||| |||||| |
|
|
| T |
31132545 |
actcccttataatgccaacaacca |
31132522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University