View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_204 (Length: 278)
Name: NF0928_low_204
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_204 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 182
Target Start/End: Original strand, 54473703 - 54473885
Alignment:
| Q |
1 |
atctaattttgacaaatgactaaaatacatttttatggatgaatccgtagagagaactcaaattcgaatatggcgagaatattcattgaccagaatttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54473703 |
atctaattttgacaaatgactaaaatacatttttatggatgaatccgtagagagaactcaaattcgaatatggcgagaatattcattgaccagaatttac |
54473802 |
T |
|
| Q |
101 |
cctcttccccccaaaaactaga-ggttaagcccgaaaaactaacattatcattaataacttgttcaaacaataacctgcaggt |
182 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54473803 |
cctcttccccccaaaaactagagggttaagcccgaaaaactaacattatcattaataacttgttcaaacaataacctgcaggt |
54473885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 314 times since January 2019
Visitors: 6714