View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_211 (Length: 268)
Name: NF0928_low_211
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_low_211 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 99 - 200
Target Start/End: Original strand, 38051494 - 38051594
Alignment:
Q |
99 |
gagagagacacgtggtagcatttcctcatgcattccaccgtacatattgcaacacttaccagcttttggtaatgcataccttgtcctctctgctcctcct |
198 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || ||||||| |
|
|
T |
38051494 |
gagagagacacgtggtagcatttcctcatgcattccaccgtacatattgcaacacttaccagc-tttggtaatgcataccttgtcctcattgatcctcct |
38051592 |
T |
 |
Q |
199 |
ca |
200 |
Q |
|
|
|| |
|
|
T |
38051593 |
ca |
38051594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 623 times since January 2019
Visitors: 6718