View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_low_215 (Length: 263)

Name: NF0928_low_215
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_low_215
NF0928_low_215
[»] chr5 (1 HSPs)
chr5 (181-251)||(21907455-21907525)
[»] chr4 (1 HSPs)
chr4 (153-251)||(26556794-26556891)


Alignment Details
Target: chr5 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 181 - 251
Target Start/End: Original strand, 21907455 - 21907525
Alignment:
181 actaaatatggcttgtgcttaaaaaatgaacaaatataatttgctgagtttactaatgttaggttcccaaa 251  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||    
21907455 actaaatatggcttgtgcttaaaaaatgaacaaatataatttgctgagtttgctaacgttaggttcgcaaa 21907525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 153 - 251
Target Start/End: Original strand, 26556794 - 26556891
Alignment:
153 gaaaattgatagtagtacttaaaatttgactaaatatggcttgtgcttaaaaaatgaacaaatataatttgctgagtttactaatgttaggttcccaaa 251  Q
    |||||| ||||||||||||||||| |||| |||||| ||||||||||||||||||| |||||||||||| | |||||||||| ||||||||||| ||||    
26556794 gaaaatcgatagtagtacttaaaacttgaataaatacggcttgtgcttaaaaaatg-acaaatataattggttgagtttactgatgttaggttcgcaaa 26556891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University