View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_low_216 (Length: 263)

Name: NF0928_low_216
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_low_216
NF0928_low_216
[»] chr3 (1 HSPs)
chr3 (41-243)||(52049464-52049664)


Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 41 - 243
Target Start/End: Complemental strand, 52049664 - 52049464
Alignment:
41 aaagcttgcgccactcaatattgataaaaggtttattggttaccctgctgctgctttaggagcaaactttaaattagttcaagtaaa-taaataataaaa 139  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||| ||||||||||||    
52049664 aaagcttgcgccactcaatattgataaaaggtttattggttaccctgctgct---ttaggagcaaactttaaattagttcaagtaaaataaataataaaa 52049568  T
140 atgaggaaaatctatacatacgtaggtttataatgcttcgtggttcatccggattctacacgtatgccatttacgatcatttgaaggaatggcctgccta 239  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
52049567 atgaggaaaatctatacatacgtaggtttataatgcttcgtggttcatccggattctacacgtatgccatttacgatcatttgaaggaatggcctgcctt 52049468  T
240 tgat 243  Q
    ||||    
52049467 tgat 52049464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 506 times since January 2019
Visitors: 6717