View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_216 (Length: 263)
Name: NF0928_low_216
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_216 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 41 - 243
Target Start/End: Complemental strand, 52049664 - 52049464
Alignment:
| Q |
41 |
aaagcttgcgccactcaatattgataaaaggtttattggttaccctgctgctgctttaggagcaaactttaaattagttcaagtaaa-taaataataaaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52049664 |
aaagcttgcgccactcaatattgataaaaggtttattggttaccctgctgct---ttaggagcaaactttaaattagttcaagtaaaataaataataaaa |
52049568 |
T |
 |
| Q |
140 |
atgaggaaaatctatacatacgtaggtttataatgcttcgtggttcatccggattctacacgtatgccatttacgatcatttgaaggaatggcctgccta |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52049567 |
atgaggaaaatctatacatacgtaggtttataatgcttcgtggttcatccggattctacacgtatgccatttacgatcatttgaaggaatggcctgcctt |
52049468 |
T |
 |
| Q |
240 |
tgat |
243 |
Q |
| |
|
|||| |
|
|
| T |
52049467 |
tgat |
52049464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University