View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_220 (Length: 261)
Name: NF0928_low_220
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_220 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 24 - 216
Target Start/End: Complemental strand, 43306670 - 43306475
Alignment:
| Q |
24 |
agagagtgtcaatattagtcctttaaactcttacaaagttcgtataaattaaattacaatacatagtgcagcttttaaagtnnnnnnngaggggg----g |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |
|
|
| T |
43306670 |
agagagtgtcaatattagtcctttaaactcttacaaagttcgtataaattaaattacaatacatagtgcagcttttaaagtaaaaaa-gagggggagggg |
43306572 |
T |
|
| Q |
120 |
aggatgtagtttacccctttgtttctctttattcttctaatctaaggaagaaaaaagtactgaggaagcacccgggaaactgatggaagcaaaagct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43306571 |
gggatgtagtttacccctttgtttctctttattcttctaatctaaggaagaaaaaagtaccgaggaagcacccgggaaactgatggaagcaaaagct |
43306475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 850 times since January 2019
Visitors: 6705