View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_225 (Length: 257)
Name: NF0928_low_225
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_225 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 30 - 257
Target Start/End: Original strand, 45936969 - 45937211
Alignment:
| Q |
30 |
cttatcatcacagcttttattagctgggcttttcttcgggagaaattatatgttggaacgtaagcaatttaattgattaattagttcataattacatata |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45936969 |
cttatcatcacagcttttattagctgggcttttcttcgggagaaattatatgttggaacgtaagcaatttaattgattaattagttcataattacatata |
45937068 |
T |
|
| Q |
130 |
attatatttagtagtactaattatggtcta---------------actatagtgcattagggtctctgctgatagttggtggactatattctgttctatg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45937069 |
attatatttagtagtactaattatggtctatattgatttggtactactatagtgcattagggtctctgctgatagttggtggactatattctgttctatg |
45937168 |
T |
|
| Q |
215 |
gggaaagagcaaagaggttgataacaacaaagtggaggatgct |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45937169 |
gggaaagagcaaagaggttgataacaacaaagtggaggatgct |
45937211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 167 - 247
Target Start/End: Original strand, 10562609 - 10562689
Alignment:
| Q |
167 |
tgcattagggtctctgctgatagttggtggactatattctgttctatggggaaagagcaaagaggttgataacaacaaagt |
247 |
Q |
| |
|
|||| ||||||||||| |||| |||||||| ||||| || |||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
10562609 |
tgcaatagggtctctgttgattgttggtgggttatatgcttttctgtggggaaagagcaaagaggtggataacaacaaagt |
10562689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 88
Target Start/End: Original strand, 10562550 - 10562608
Alignment:
| Q |
30 |
cttatcatcacagcttttattagctgggcttttcttcgggagaaattatatgttggaac |
88 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||| |||||||||||| |||||||| |
|
|
| T |
10562550 |
cttatcctcacagcttttattagctgggcttttattcaggagaaattatacgttggaac |
10562608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 117 times since January 2019
Visitors: 6713