View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_227 (Length: 255)
Name: NF0928_low_227
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_227 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 25 - 255
Target Start/End: Complemental strand, 35613203 - 35612972
Alignment:
| Q |
25 |
ataaacctgccctctatcctgctatgacctttgatgaatataggcttttcattagaatgaggggtccatgtggaaaatctcaagtagaatctttaaaatc |
124 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35613203 |
ataaacctgccctctaccctgctatgacctttgatgaatataggcttttcattagaatgaggggtccatgtggaaaatctcaagttgaatctttaaaatc |
35613104 |
T |
 |
| Q |
125 |
tccaagatgatatgcatgtttggatcagtggtaagtctacaaaagcacgataacatctacattgttggtttatgtgtcaatgaggcaagagacgcgtgtt |
224 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||| |||| |||||| ||||||||| |||| |||| ||||||| ||| |||||||||| ||||| |
|
|
| T |
35613103 |
tccaagatgatacgcatgtttggatcagcggtaagtctataaaatcacgatgacatctacactgtttgtttttgtgtcagtgaagcaagagacgtgtgtt |
35613004 |
T |
 |
| Q |
225 |
tttt-agaagctactattaaaatttcaaaaga |
255 |
Q |
| |
|
|||| |||||||||||||||| |||| ||||| |
|
|
| T |
35613003 |
ttttcagaagctactattaaagtttcgaaaga |
35612972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 29 - 116
Target Start/End: Complemental strand, 31789833 - 31789746
Alignment:
| Q |
29 |
acctgccctctatcctgctatgacctttgatgaatataggcttttcattagaatgaggggtccatgtggaaaatctcaagtagaatct |
116 |
Q |
| |
|
|||||| ||||| || || |||||||||||||| || || || ||||||||||||||||| || ||||| ||||||||||| |||||| |
|
|
| T |
31789833 |
acctgcactctacccagcaatgacctttgatgagtacagactcttcattagaatgaggggaccttgtggcaaatctcaagttgaatct |
31789746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University